Pache.co Information Technologies

The di locus maps with a gene transcribing a miR172 precursor sequence

In the attempt to more precisely delimit the di locus position on chr 2, linkage disequilibrium (LD) pattern around the 23 – 26.5 Mb genomic interval enclosing the two associated GWAS signals was inspected in 21 Oriental DF accessions, using about 4K SNPs extracted from whole-genome sequencing (WGS) data [21]. The LD map showed a complex pattern characterized by spaced and relatively short regions with long-range high LD levels, defining an interval of about 2.4 Mb, approximately comprised between SNP1456516 (24,277,038) and SNP1501405 (26,628,544) (Supplementary Figure S1). At least 381 gene models were annotated in this interval, based on a peach reference transcripts v2.1 annotations (Supplementary Table S1). Homology-based searches of genes putatively involved in flower tissues differentiation, growth and/or development allowed the identification of a predicted gene (Prupe.2G237700), transcribing a microRNA precursor sequence belonging to the miR172 family, previously classified as ppe-miR172e [28] and hereafter named ppe-miR172d (as currently annotated on www.mirbase.org, accession: MI0026098). Indeed, an increasing body of knowledge around the role of the euAP2/TOE-miR172 module in the regulation of petaloidy in various species [27] makes Prupe.2G237700 a prime candidate for the recessive DF trait. Firstly, the sequence of the miR172d primary transcript was annotated by mapping RNA-seq reads from peach dormant buds of various stages and carpel tissues. The expressed pri-miR172d sequence has no introns, spanning ~2.0 Kb from 25,860,117 to 25,861,987 bp, with the predicted pre-miR172d precursor sequence (119 nt) starting at 25,860,595 (Fig. 1).

Genomic structure of the micro-RNA miR172d encoding transcript Prupe.2G237700. The pri-miRNA sequence was identified by mapping transcriptome data from various peach flower tissues (petal, stamen, carpel). The predicted pre-miR172d stem-loop hairpin structure is also shown

Full size image

Genomic structure of the micro-RNA miR172d encoding transcript Prupe.2G237700. The pri-miRNA sequence was identified by mapping transcriptome data from various peach flower tissues (petal, stamen, carpel). The predicted pre-miR172d stem-loop hairpin structure is also shown

Three independent mutant alleles of Prupe.2G237700 are associated with the recessive double-flower trait

Several primer pairs covering the entire pri-miR172d sequence plus ~1 Kb upstream and downstream were designed to analyze allelic polymorphisms in various ornamental materials, including main commercial cultivars, and accessions or selections retrieved from reliable germplasm collections of INRAE-GAFL (France), University of Milan (Italy), USDA-ARS (Kearneysville, West Virginia, and Byron, Georgia) and Clemson University (South Carolina) (the accession list is provided in Table 1). In agreement with the recessive inheritance of the di trait, causal variant(s) were assumed to be homozygous in DF genotypes. Interestingly, primers 2G237700_F1 and 2G237700_R2 resulted the most informative, as PCR showed a diverse pattern of amplifications in the various accessions (Fig. 2): in single-flower (SF) accession ‘Crimson Rocket’ the wild-type (Di) amplicon of 563 bp (SF ‘Lovell’ peach genome) was observed, as well as in two DF selections ‘KV045590’ and ‘KV021779’; another SF accession, ‘Redleaf Pillar’, showed the 563 bp amplicon alongside a second PCR product of about 5.5 Kb. This PCR product, about 5.0 Kb longer than the wild-type (Di) allele, was exclusively obtained in DF accessions ‘Hokimomo op’, KV872615, ‘Compact Pillar’, ‘Peppermint Stick’, S10321 ‘Hua 5-15’, S10322 ‘Hua 5-25’ and ‘Okinawa’. Interestingly, the other four DF accessions (S7258 ‘clone IRAN 6:59’, ‘Kikoumomo D’, ‘G. Biffi fiore doppio’ and ‘Helen Borchers’) showed an amplicon of ~1.7 Kb (suggestive of an insertion of ~1.2 Kb compared to the Di allele). Finally, three additional DF accessions showed no amplification (among them ‘Klara Meyer’). Sanger sequencing of the 1.7 Kb amplicon revealed a 1,198 bp insertion without LTR elements (named di² located at position +297 (Pp02:25,860,414) from the pri-miR172d transcription initiation site (Supplementary File S1). BLAST searching showed no clear similarity with known genes or transposable elements, although identical sequences are spread across several peach chromosomes. Instead, a long-read Oxford Nanopore Technology (ONT) approach was used to sequence the miR172d allelic variants in ‘Klara Meyer’ and ‘S10321 Hua 5-15’, as representative of the genotypes respectively yielding no amplification and the 5.5 Kb amplicons with 2G237700_F1 and 2G237700_R2. Whole-genome coverage was ~10 and ~20x, respectively for ‘Klara Meyer’ and ‘Hua 5-15’, with estimate read length N50 of 32.5 and 21.2 Kb. After aligning to the Peach V2.0 reference genome, two different allelic variants were discovered at the miR172d locus: a ~9.5 Kb deletion (Pp02:25,855,441 to Pp02:25,864,957) encompassing the whole miR172 miRNA precursor sequence including its flanking DNA regions, named di^Δ; a ~5.0 Kb LTR insertion (hereafter di¹), located at position +221 (Pp02:25,860,344) from the pri-miR172d transcription initiation site (Fig. 3).

Molecular analysis of sequence variants of the miR172d gene. A Genomic structure of Prupe.2G237700 (purple box) and position of pre-miR172d encoding sequence (red segment). Arrowheads indicate the positions of the primers used for PCR analysis. B Phenotype of double-flower accessions used in this study. Left to right, Top: ‘KV872615’, ‘Compact Pillar’, ‘S7258 cl. IRAN 6:59’, ‘S10321 Hua 5-15’; Bottom: ‘Klara Meyer’, ‘S10322 Hua 5-25’, ‘Kikoumomo D (KV044770)’, ‘Hokimomo op’ (trees and flowers photos were provided by C. Dardick and V. Signoret). C PCR analysis of the single and double-flower accessions listed in Table 1

ONT long-sequencing reads alignment at di locus in ‘S10321 Hua 5-15’ and ‘Klara Meyer’ accessions. At the top: reads breakpoint due to a ~5.0 Kb LTR insertion (di¹) located at position +221 (Pp02:25,860,338) from the pri-miR172d transcription initiation site. At the bottom: a ~9.5 Kb deletion (di^Δ) from (Pp02:25,855,441 to 25,864,957), encompassing the entire pri-miR172 precursor sequence including its flanking DNA regions in ‘Klara Meyer’

The di¹ insertion showed homology with a putative FRS5-LIKE gene of the FARS (FAR-RED IMPAIRED RESPONSE1 RELATED SEQUENCE) transcription factors family derived from Mutator-like element (MULE) transposases [29]. Validation of the three allelic variants of the di locus was performed through PCR analyses. Specific primer combinations confirmed the presence of the homozygous di¹ insertion found in ‘Hua 5-15’ also in other six DF accessions: ‘Houki Momo op’, ‘KV872615’, ‘Compact Pillar’, ‘Peppermint Stick cl.’, ‘Hua 5-25’ and ‘Okinawa’ (Supplementary Figure S2); consistent with the recessive inheritance of the di trait, the di¹ allele was amplified in the heterozygous SF accession ‘Redleaf Pillar’. Finally, the two remaining DF selections ‘KV045590’ and ‘KV021779’ showing the wild-type Di/Di genotype (i.e. 563 bp amplicon) both resulted heterozygous (Di2/di2) for the PETALOSA variant (underlying the dominant inherited Di2 allele) [24] (Table 1). In addition to the panel of ornamental cultivars, the absence (in homozygosis) of any of the three identified di variant(s) in single-flower accessions was further confirmed in a genetically diversified panel of 151 accessions from the PeachRefPop collection [30] (data not shown).

Thus, at least three distinct mechanisms acting on the miR172d gene underpin the recessive double flower trait in peach: di¹ (a ~5.0 Kb insertion), di² (a ~1.2 Kb insertion) and di^Δ (a ~9.5 Kb deletion) (Fig. 4).

Structural variants identified at the gene encoding micro-RNA miR172d, Prupe.2G237700. The wt genomic structure of Prupe.2G237700 is represented by a light lilac box and the red segment indicates the position of the pre-miR172d encoding sequence. Insertions in alleles di¹ and di² are represented by a dark purple box, with LTR regions marked in lighter purple in di¹. The genomic region deleted in di^Δ is indicated by the dotted/shaded region

Full size image

Structural variants identified at the gene encoding micro-RNA miR172d, Prupe.2G237700. The wt genomic structure of Prupe.2G237700 is represented by a light lilac box and the red segment indicates the position of the pre-miR172d encoding sequence. Insertions in alleles di¹ and di² are represented by a dark purple box, with LTR regions marked in lighter purple in di¹. The genomic region deleted in di^Δ is indicated by the dotted/shaded region

Pre-miR172d expression is abolished in homozygous di
¹, di
² and di
^Δ genotypes

The expression profile of pre-miR172d was investigated using qRT-PCR in pooled bud flower tissues from two developmental stages and three di variants: ‘Okinawa’ (di¹/di¹), ‘clone IRAN 6:59’ (di²/di²) and ‘Klara Meyer’ (di^Δ/di^Δ). The pre-miR172d was only expressed in the SF control accession ‘Bounty’ (Di/Di), being undetectable in all the three DF accessions (Fig. 5). These findings were clearly consistent with the complete deletion of miR172d sequence in the di^Δ allele; in case of di¹ and di² alleles, transposon-induced gene silencing mechanisms could be the most probable explanation, although the exact mechanism(s) leading to their miss-expression should be more specifically addressed.

Expression pattern of pre-miR172d in pooled flower bud tissues from Baggiolini stage B (flower bud swelling) to C1 (flower buds apparent) from ‘Bounty’ (single-flower), ‘Klara Meyer’ (double-flower, di^Δ), ‘S7258 cl. IRAN 6:59’ (double-flower, di²) and ‘Okinawa’ (double-flower, di¹) genotypes. Actin (Prupe.6G163400) was used as a reference to normalize expression data

Full size image

Expression pattern of pre-miR172d in pooled flower bud tissues from Baggiolini stage B (flower bud swelling) to C1 (flower buds apparent) from ‘Bounty’ (single-flower), ‘Klara Meyer’ (double-flower, di^Δ), ‘S7258 cl. IRAN 6:59’ (double-flower, di²) and ‘Okinawa’ (double-flower, di¹) genotypes. Actin (Prupe.6G163400) was used as a reference to normalize expression data

Distribution of allelic variants in DF varieties of germplasm collections

The availability of phenotypic and genotypic information on peach ornamental accessions across important Chinese collections, allowed exploring the allelic assortment at both di and Di2 loci. The presence of allelic variants (and co-segregation with flower phenotype) was assessed through a sequencing-based method (Supplementary Figure S3 and Materials and Methods section) using public WGS data (retrieved from NCBI SRA database) of 41 peach accessions with clear flower trait (double or semi-double) and sufficient genome coverage (i.e. > 10x), and several SF accessions as control. Among the DF accessions, 21 were homozygous di¹/di¹ (including the dwarf DF ‘Bonanza peach’, probably erroneously indicated as SF), 7 homozygous di²/di² and ‘Ju Hua Tao’ carried the di¹/di² allelic combination (Supplementary Table S2); in this last case, the concomitant presence of di¹ and di² alleles suggests that both mutations are functionally equivalent; surprisingly, the di^Δ variant seems to be absent in Chinese germplasm collections, suggesting the hypothesis that this allele originated after the arrival of peach in Europe (tracing back to the Greek-Roman era). Apart from the di locus, 7 DF accessions resulted heterozygous for the PET-Di2 variant (Supplementary Table S2). Interestingly the DF accession ‘Hua Yu Lu’ was homozygous for Di and di2 alleles but showing a heterozygous SNP within the core miR172 recognition sequence at the three-prime end portion of the coding sequence of the PET gene (Supplementary Figure S4).

Total RNA was collected from pooled flower bud tissues from Baggiolini stage B (flower bud swelling) to C1 (flower buds apparent). RNA was treated with DNase I (Takara) and extracted using TRIzol (Thermo Fisher Scientific) followed by phenol extraction; 1 μg of total RNA was reverse-transcribed using random hexamers and SuperScript III RT (Thermo Fisher Scientific). According to Zhu et al. (2012), specific primers for pre-miR172d amplify a 90 bp region including mature miR172d, located 84 nt from the 5’-prime end of the precursor sequence (Supplementary File S1): pre-miR172d_For (AGCATCATCAAGATTCACAATTTC) and pre-miR172d_Rev (TGCCGCTGCAGCATCATCAAGA). Real-time PCR reaction were carried out using Power SYBR Green qPCR Supermix (Thermo Fisher Scientific). Each reaction was performed in triplicate on QuantStudio 3 Real-Time PCR Systems (Thermo Fisher, United Kingdom) using the following cycling conditions: 95°C for 10 min, 40 cycles at 95°C for 20 s, 56°C for 25 s, and 72°C for 30 s. Each thermal cycle was followed by a melting curve stage, with temperatures ranging from 60°C to 95°C. Pre-miR172d relative expression was calculated using ∆C_t method [55], using Actin (Prupe.6G163400) as reference gene [56]. RT-PCR products were run on 2.0% agarose gels with Midori staining and visualized under UV light. Three to four biological pool replicates were analyzed for each sample.

Takane Lui
https://www.youtube.com/channel/UCs9_O1tRPMQTHQ-N_L6FU2g

Source
#たかねの見物 #ルイ友 #Luillust
【HoloCure】お披露目までにクリアせよ‼集合体恐怖症克服できる！？【鷹嶺ルイ/ホロライブ】

使用BGM
□DOVA-SYNDROME
　HP： https://dova-s.jp/

#ホロライブ
#Hololive

★　Related Videos 　★

Chloe Desk-Slams IRL…【Hololive】

Subaru Presses F5 and Blows Towa’s Mind【Hololive】
https://youtu.be/8wP5XAdn4DA

Trick lässt sich in Trance versetzen, damit er in eine andere Welt eintreten kann, in der er herausfinden will, was das große Unheil ist, das auf die Faes zukommen wird. In dieser Welt trifft er auf seine verstorbene Frau, die im großen Fae-Krieg getötet wurde. Trick hat den großen Fae-Krieg vor langer Zeit beendet, indem er mit seinem Blut Gesetze verfasst hat. Tricks Frau möchte nun von ihm, dass er die Gesetze wieder umschreibt, damit sie so zu ihm zurückkehren kann. In dem Moment, in dem er sich in die Hand schneidet um sein Blut zu benutzen, taucht ein Garuda auf, der Trick erklärt, was er einst damit ausgelöst hat, als er dem großen Fae-Krieg ein Ende setzte. Die Garuda ernähren sich von Aggressionen und Hass und haben seither keine Chance mehr gehabt, sich ausreichend zu ernähren. Da zwischen den Fae des Lichts und den Fae der Finsternis immer mehr Auseinandersetzungen stattfinden, haben die Garuda nun wieder die Chance sich ausreichend zu ernähren. Genau diese Auseinandersetzung zwischen den Faes will der Garuda provozieren, und so stellt sich heraus, was das Böse ist, dass in Zukunft auf die Faes zukommt. Zur gleichen Zeit will sich Bo an Lachlan rächen, weil er sie in Bezug auf Lauren und Nadia belogen hat. Es findet ein langer Kampf zwischen den beiden statt und während dieses Kampfes stellt sich heraus, dass Lachlan Bo die ganze Zeit nur getestet hat, um zu sehen, ob sie die Kraft hat mit ihm zusammen gegen das bevorstehende Böse zu kämpfen. Die Garuda.

An overnight cleaner who has worked scrubbing, mopping and disinfecting the halls and classrooms of Brooklyn Law School for 36 years is fighting the school, after being given only three weeks notice that he was losing his union contract and health benefits, and having his hourly wage almost cut in half.

Luis Pacheco, 54, has worked as an overnight cleaner at Brooklyn Law School since 1986, taking over from his father. His father worked there from 1969, only stepping down due to struggles with diabetes that saw him lose his kidneys.

On June 6, Pacheco was told the school had changed the cleaning contractor from Triangle to Advantage Cleaning, and that to keep their jobs, he and six colleagues would have to sign new, non-union contracts starting today, July 1.

The new contract will see him lose his health benefits, have his hours decreased, with no vacation or sick days, and have his hourly wage cut from $30 to $17 per hour, he told BK Reader.

Since then, Pacheco—who also suffers from diabetes—has been scrambling to fight the sudden changes.

“I feel so bad. Me and my wife work in the same building. We will both lose our benefits, and how will we pay the mortgage?

“I can’t sleep, only two or three hours, and then I show up to try to protest the decision. I’ve never felt this bad in my life,” he said.

Throughout his decades of work at the Brooklyn Law School, Pacheco—who has been the overnight cleaning foreman for 20 years—has seen several different cleaning companies take over the overnight contract, but they have all honored the workers’ 32BJ SEIU union contracts.

At a rally outside Brooklyn Law School Thursday, 32BJ SEIU Executive Vice President and Director of the Commercial Division Denis Johnston said some of the workers would see their annuals salaries drop from around $60,000 to $35,000 per year, as well as losing their employer-paid Empire Blue Cross Blue Shield healthcare coverage.

“When [Advantage] comes in tomorrow they’re going to have to bargain with 32BJ and we’re going to continue this fight with them until they agree that they’ll maintain what you guys have had all these years of working here,” he said.

The workers were told they would have 30 days to fill their prescriptions before they were uninsured.

For Pacheco, this means scrambling to get supplies to manage him and his wife’s diabetes. The medication price will spike from $40 co-pay per month to $300 per month, he said.

Pacheco also has ligament damage due to the heavy duty scrubbing and washing he does every week on the job. Three years ago, the union contract paid for the $22,000 surgery he needed in his right arm. Now the problem is in his left arm, and he doesn’t know how he would pay for surgery, he said.

“But I don’t stop working because I love my job,” he said. “We are hardworking people.”

The company has also asked him and other employees to download a company app. In it, they have to upload a photo of what they’re doing every 20 minutes, Pacheco said.

A complaint has been filed against Advantage Cleaning with the National Labor Relations Board. The complaint alleges violations of the cleaners’ right to organize, citing statements made to workers, Johnston said.

“Brooklyn Law School should not be removing good union jobs and lowering labor standards. These workers have put in decades of their lives serving the Brooklyn Law School community, now is not the time to strip them of their healthcare, retirement benefits and reduce their wages.”

Denis Johnston, 32BJ Executive Vice President and Director of the Commercial Division gave an update on the situation: pic.twitter.com/ASoTyD7ies

— 32BJ SEIU /// #UnionStrong 💪💪🏻💪🏽💪🏿 (@32BJSEIU)

In a statement given to BK Reader Thursday, Brooklyn Law School said it “in no way” harbored anti–union animus. It said it respects the right of employees to choose whether to be represented by the union.

“Brooklyn Law School recognizes that this is a matter between Advantage Cleaning LLC and 32BJ SEIU based on the charge filed yesterday with the National Labor Relations Board.”

However, the school has faced mounting pressure to help Pacheco and the other cleaners after replacing the “responsible” cleaning contractor Triangle with a non-union one.

After finding out about the workers’ situation this Monday, a group of Brooklyn Law School students have been “working tirelessly” to bring it to light, law student Will Cooper said.

The students started a Change.org petition demanding the school reverse the “anti-worker” decision. They also started an email campaign to every faculty member, Brooklyn Law School Dean Michael T. Cahill, and the school Board of Trustees.

Cooper said Board Chairman Francis Aquila met with them Friday morning and it “seems the school is considering its options.”

“They know we’re not backing down and we hope they’re going to make the right decision,” he said.

Brooklyn Law School told BK Reader Friday morning it had an update on the labor dispute. It had not sent the update by time of publishing.

BK Reader reached out to Advantage Cleaning for comment multiple times via phone and email. Reached on an office number, the man who answered said the company did not have a contract with Brooklyn Law School and hung up. Reached on a cellphone for owner Omar Miller, the same man said Miller was not in and hung up.

Update 1pm Friday: Brooklyn Law School has issued a statement to BK Reader that it is now exploring alternative arrangements for its cleaning services and is in talks with other vendors who have unionized workforces.

“In talks with these other vendors, Brooklyn Law School has been assured that all of the employees of our former vendor will be offered positions that will include the same pay and benefits as they previously received.”

Your contribution is appreciated.

Make a Donation

BK Reader is brought to you for free daily. Please consider supporting independent local news by making a donation here. Whether it is $1 or $100, no donation is too big or too small!

Share this story!

As I’ve said elsewhere, although I dig the official in-game dance emotes for Bella Poarch‘s “Build a B*tch” and Rick Astley‘s “Never Gonna Give You Up,” I don’t normally like to play Fortnite. But hey, as a self-admitted patsy for corporate crossover events (bring back Amalgam Comics, please!)—I decided to read the June issue, Fortnite X Marvel: Zero War #1, written by Christos Gage and Epic Games’ Chief Creative Officer Donald Mustard and drawn by artist Sergio Davíla. And g-d dammit, I really enjoyed it. Although I won’t be logging into Fornite anytime soon to redeem item codes, I will be picking up the rest of the series.

Fortnite X Marvel: Zero War

With Zero War #2 arriving in local comic shops on July 13th, Marvel recently unveiled the variant covers for the third issue in the limited series. Learn more about the Fortnite/Marvel crossover event below!

Fortnite and Marvel heroes are currently fighting alongside each other to save both their universes from total annihilation in the pages of FORTNITE X ZERO WAR, a new limited comic series written by Christos Gage and Epic Games’ Chief Creative Officer Donald Mustard and drawn by artist Sergio Davíla. Fans who witnessed last month’s explosive debut issue and are gearing up for the second issue next week can now check out all six covers of ZERO WAR #3, on sale August 17!

ZERO WAR #3 will see the hunt for the Zero Shard continue into the Savage Land. Artists Francis Leinil Yu, Peach Momoko, and Ron Lim have brought the upcoming battle to life while artists Frank Cho and Carlos Pacheco depict exciting new Fortnite team-ups with Storm, Hawkeye, and more! Plus, Derrick Chew delivers a romantic piece of one of Marvel’s most iconic couples, Rogue and Gambit, who debuted on the Fortnite Island earlier this year!

Each first print issue (physical copies only) of ZERO WAR contains a redeemable code to unlock a bonus digital cosmetic in Fortnite! Digital single-issue comic book purchases of ZERO WAR do not include any redeemable codes for Fortnite in-game bonus rewards. For more information, visit Marvel.com.

Note that although Epic Games originally announced that digital comics purchased through the Marvel Comics app would include redeemable item codes, that is not true. Instead, only physical copies of the comics will contain redeemable codes to unlock bonus digital cosmetic items in Fortnite. However, there is one exception to the physical copies only rule: if you are a Marvel Unlimited user with a paid subscription and registered account, you can receive codes for all six cosmetic items by reading all five issues before October 28^th, 2022.

Here are the in-game items Marvel and Fortnite fans can look forward to unlocking in the coming months:

And here is a slew of variant covers for Zero War #3!

On Sale 8/17

Cover by LEINIL FRANCIS YU & SUNNY GHO

Variant Cover by CARLOS PACHECO, RAFAEL FONTERIZ & JESUS ABURTOV

Variant Cover by RON LIM & ISRAEL SILVA

Variant Cover by DERRICK CHEW

Variant Cover by FRANK CHO

Welcome to Funny Animals Club!

We’ve selected the best of the funniest and cutest Cats😹 & Dogs🐶 videos that will make you laugh all day long.

Enjoy watching this Funny Video!

Try not to laugh!

Lisa erkennt die volle Tragweite der finanziellen Situation, während Alvey versucht, sie davon zu überzeugen, dass Ryan die langersehnte Lösung für ihre Probleme darstellt. Ryan gewöhnt sich derweil an das Leben im offenen Vollzug. Jay möchte wieder anfangen zu kämpfen. © 2014 Navy Street Productions, LLC. All Rights Reserved.

Hondos S.W.A.T.-Team will vier entflohene Häftlinge dingfest machen – bevor dies einer rivalisierenden Einheit gelingt. Als ein Cop vom Protokoll abweicht, steht Hondos Führung in der Kritik.